|
ATCC
t5 caption a7 strain T5 Caption A7 Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/t5 caption a7 strain/product/ATCC Average 96 stars, based on 1 article reviews
t5 caption a7 strain - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 streptococcus mutans strain serotype mic ![]() Caption A7 Streptococcus Mutans Strain Serotype Mic, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 streptococcus mutans strain serotype mic/product/ATCC Average 99 stars, based on 1 article reviews
caption a7 streptococcus mutans strain serotype mic - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 source organism j denitrificans strain atcc 14870 dna source synthetic dna forward primer 5 ccgtagcaat ggatcc atgaagaagagaaagttgagagcgtcagc ![]() Caption A7 Source Organism J Denitrificans Strain Atcc 14870 Dna Source Synthetic Dna Forward Primer 5 Ccgtagcaat Ggatcc Atgaagaagagaaagttgagagcgtcagc, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 source organism j denitrificans strain atcc 14870 dna source synthetic dna forward primer 5 ccgtagcaat ggatcc atgaagaagagaaagttgagagcgtcagc/product/ATCC Average 93 stars, based on 1 article reviews
caption a7 source organism j denitrificans strain atcc 14870 dna source synthetic dna forward primer 5 ccgtagcaat ggatcc atgaagaagagaaagttgagagcgtcagc - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 recipient strain mobilization frequency b pnit6012 pnit101 p putida kt2440 ![]() Caption A7 Recipient Strain Mobilization Frequency B Pnit6012 Pnit101 P Putida Kt2440, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 recipient strain mobilization frequency b pnit6012 pnit101 p putida kt2440/product/ATCC Average 94 stars, based on 1 article reviews
caption a7 recipient strain mobilization frequency b pnit6012 pnit101 p putida kt2440 - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 strain genotype strain description bb120 atcc baa ![]() Caption A7 Strain Genotype Strain Description Bb120 Atcc Baa, supplied by ATCC, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 strain genotype strain description bb120 atcc baa/product/ATCC Average 98 stars, based on 1 article reviews
caption a7 strain genotype strain description bb120 atcc baa - by Bioz Stars,
2026-04
98/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 parental yeast strains genotype parent plasmid reference 972 wild type atcc ![]() Caption A7 Parental Yeast Strains Genotype Parent Plasmid Reference 972 Wild Type Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 parental yeast strains genotype parent plasmid reference 972 wild type atcc/product/ATCC Average 99 stars, based on 1 article reviews
caption a7 parental yeast strains genotype parent plasmid reference 972 wild type atcc - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 strain zone diam mm range mic ![]() Caption A7 Strain Zone Diam Mm Range Mic, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 strain zone diam mm range mic/product/ATCC Average 99 stars, based on 1 article reviews
caption a7 strain zone diam mm range mic - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 source organism s mutans dna source s mutans strain ua159 ![]() Caption A7 Source Organism S Mutans Dna Source S Mutans Strain Ua159, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 source organism s mutans dna source s mutans strain ua159/product/ATCC Average 96 stars, based on 1 article reviews
caption a7 source organism s mutans dna source s mutans strain ua159 - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 s pneumoniae strain pae h telithromycin jnj 1 jnj 2 atcc ![]() Caption A7 S Pneumoniae Strain Pae H Telithromycin Jnj 1 Jnj 2 Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 s pneumoniae strain pae h telithromycin jnj 1 jnj 2 atcc/product/ATCC Average 90 stars, based on 1 article reviews
caption a7 s pneumoniae strain pae h telithromycin jnj 1 jnj 2 atcc - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 strain pae ![]() Caption A7 Strain Pae, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 strain pae/product/ATCC Average 90 stars, based on 1 article reviews
caption a7 strain pae - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
ATCC
t5 caption a7 cev2 sensitive strains cev2 resistant strains pathogenic bacteria e coli o157 h7 edl 933 ![]() T5 Caption A7 Cev2 Sensitive Strains Cev2 Resistant Strains Pathogenic Bacteria E Coli O157 H7 Edl 933, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/t5 caption a7 cev2 sensitive strains cev2 resistant strains pathogenic bacteria e coli o157 h7 edl 933/product/ATCC Average 97 stars, based on 1 article reviews
t5 caption a7 cev2 sensitive strains cev2 resistant strains pathogenic bacteria e coli o157 h7 edl 933 - by Bioz Stars,
2026-04
97/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 strain gyrb pare grlb mic ![]() Caption A7 Strain Gyrb Pare Grlb Mic, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 strain gyrb pare grlb mic/product/ATCC Average 99 stars, based on 1 article reviews
caption a7 strain gyrb pare grlb mic - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Antimicrobial Agents and Chemotherapy
Article Title: Antibacterial and Antibiofilm Activities of a Novel Synthetic Cyclic Lipopeptide against Cariogenic Streptococcus mutans UA159
doi: 10.1128/AAC.00776-17
Figure Lengend Snippet: In vitro susceptibilities of planktonic S. mutans UA159
Article Snippet: These results showed that CLP-4 is a promising agent that can effectively inhibit planktonic growth of S. mutans . table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Antimicrobial agent MIC and MBC (μg/ml) by inoculum density of: 6 × 10 5 CFU/ml 2 × 10 7 CFU/ml MIC MBC MIC MBC CLP-4 2.8 6 5 20 Erythromycin 0.016 0.6 0.062 1 Chlorhexidine dihydrochloride 1.25 3.5 1.25 5 Open in a separate window In vitro susceptibilities of planktonic S. mutans UA159 table ft1 table-wrap mode="anchored" t5 TABLE 2
Techniques: In Vitro
Journal: Antimicrobial Agents and Chemotherapy
Article Title: Antibacterial and Antibiofilm Activities of a Novel Synthetic Cyclic Lipopeptide against Cariogenic Streptococcus mutans UA159
doi: 10.1128/AAC.00776-17
Figure Lengend Snippet: S. mutans strains used in this study and their in vitro susceptibilities to CLP-4
Article Snippet: These results showed that CLP-4 is a promising agent that can effectively inhibit planktonic growth of S. mutans . table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Antimicrobial agent MIC and MBC (μg/ml) by inoculum density of: 6 × 10 5 CFU/ml 2 × 10 7 CFU/ml MIC MBC MIC MBC CLP-4 2.8 6 5 20 Erythromycin 0.016 0.6 0.062 1 Chlorhexidine dihydrochloride 1.25 3.5 1.25 5 Open in a separate window In vitro susceptibilities of planktonic S. mutans UA159 table ft1 table-wrap mode="anchored" t5 TABLE 2
Techniques: In Vitro
Journal: Antimicrobial Agents and Chemotherapy
Article Title: Antibacterial and Antibiofilm Activities of a Novel Synthetic Cyclic Lipopeptide against Cariogenic Streptococcus mutans UA159
doi: 10.1128/AAC.00776-17
Figure Lengend Snippet: Comparative killing kinetics of CLP-4. S. mutans UA159 cultures at a cell density of 6 × 105 CFU/ml were challenged with 5, 10, and 25 μg/ml CLP-4 under conditions of active growth in CDM supplemented with 0.5% (wt/vol) glucose (A) and against growth-arrested cells in CDM lacking any carbon source (B). Samples at time zero were enumerated prior to peptide treatment. Data shown are the means and standard deviations of three biological replicates from three independent experiments.
Article Snippet: These results showed that CLP-4 is a promising agent that can effectively inhibit planktonic growth of S. mutans . table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Antimicrobial agent MIC and MBC (μg/ml) by inoculum density of: 6 × 10 5 CFU/ml 2 × 10 7 CFU/ml MIC MBC MIC MBC CLP-4 2.8 6 5 20 Erythromycin 0.016 0.6 0.062 1 Chlorhexidine dihydrochloride 1.25 3.5 1.25 5 Open in a separate window In vitro susceptibilities of planktonic S. mutans UA159 table ft1 table-wrap mode="anchored" t5 TABLE 2
Techniques:
Journal: Antimicrobial Agents and Chemotherapy
Article Title: Antibacterial and Antibiofilm Activities of a Novel Synthetic Cyclic Lipopeptide against Cariogenic Streptococcus mutans UA159
doi: 10.1128/AAC.00776-17
Figure Lengend Snippet: CLP-4 prevents S. mutans biofilm formation. (A) Biofilms inoculated with 2 × 107 CFU/ml were grown for 24 h in the presence of CLP-4, chlorhexidine, or erythromycin at concentrations ranging between 0.6× and 2× their respective MICs. Biofilm formation was quantified using crystal violet staining and expressed in percentage relative to untreated control. Shown are the means and standard deviations of three biological replicates from three independent experiments. *, P < 0.05; ***, P < 0.001 compared to untreated control. (B) Corresponding growth curve kinetics showing the MIC of CLP-4 on S. mutans UA159.
Article Snippet: These results showed that CLP-4 is a promising agent that can effectively inhibit planktonic growth of S. mutans . table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Antimicrobial agent MIC and MBC (μg/ml) by inoculum density of: 6 × 10 5 CFU/ml 2 × 10 7 CFU/ml MIC MBC MIC MBC CLP-4 2.8 6 5 20 Erythromycin 0.016 0.6 0.062 1 Chlorhexidine dihydrochloride 1.25 3.5 1.25 5 Open in a separate window In vitro susceptibilities of planktonic S. mutans UA159 table ft1 table-wrap mode="anchored" t5 TABLE 2
Techniques: Staining, Control
Journal: Antimicrobial Agents and Chemotherapy
Article Title: Antibacterial and Antibiofilm Activities of a Novel Synthetic Cyclic Lipopeptide against Cariogenic Streptococcus mutans UA159
doi: 10.1128/AAC.00776-17
Figure Lengend Snippet: Effects of CLP-4 on preformed biofilms. S. mutans UA159 biofilms were established for 24 h and then treated with increasing concentrations (1× to 10× the MIC) of CLP-4, chlorhexidine, or erythromycin. (A) Antibiofilm activities were assessed by quantifying the cell viability of treated biofilms by colony enumeration on agar plates. The means and standard deviations of three biological replicates from three independent experiments are shown. **, P < 0.01; ***, P < 0.001 compared to untreated control. (B) Biofilms treated with 10× the MICs for each antimicrobial were fluorescently labeled using the LIVE/DEAD BacLight viability stain and visualized by confocal laser scanning microscopy. Shown are the top-down three-dimensional (3D) volume rendering of biofilms at a total magnification of ×400. Bottom images represent optical planes in the xz, and vertical thin images represent yz dimensions. Membrane-compromised bacteria are stained red with propidium iodide, while intact bacteria are stained green with SYTO 9. Areas highlighted by dashed lines indicate regions of interest (ROIs) viewed at a higher magnification. Dimensions shown are 387.5 μm by 387.5 μm by 16 μm. (C) ROIs are presented at ×2,300 magnification. Dimensions shown are 68.1 μm by 68.1 μm by 16 μm.
Article Snippet: These results showed that CLP-4 is a promising agent that can effectively inhibit planktonic growth of S. mutans . table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Antimicrobial agent MIC and MBC (μg/ml) by inoculum density of: 6 × 10 5 CFU/ml 2 × 10 7 CFU/ml MIC MBC MIC MBC CLP-4 2.8 6 5 20 Erythromycin 0.016 0.6 0.062 1 Chlorhexidine dihydrochloride 1.25 3.5 1.25 5 Open in a separate window In vitro susceptibilities of planktonic S. mutans UA159 table ft1 table-wrap mode="anchored" t5 TABLE 2
Techniques: Control, Labeling, Staining, Confocal Laser Scanning Microscopy, Membrane, Bacteria
Journal: Acta Crystallographica. Section F, Structural Biology Communications
Article Title: Neutron and high-resolution room-temperature X-ray data collection from crystallized lytic polysaccharide monooxygenase
doi: 10.1107/S2053230X15019743
Figure Lengend Snippet: Macromolecule-production information
Article Snippet: Details of the cloning and protein-production procedures are summarized in Table 1 . table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Expressing, Plasmid Preparation, Sequencing, Construct, Produced
Journal: Applied and Environmental Microbiology
Article Title: Host Range of the Conjugative Transfer System of IncP-9 Naphthalene-Catabolic Plasmid NAH7 and Characterization of Its oriT Region and Relaxase
doi: 10.1128/AEM.02359-16
Figure Lengend Snippet: Deletion derivatives of the oriTN region and their mobilization. The numerals at both ends of each fragment are the nucleotide positions in the 430-bp oriTN region. Four predicted IRs with hairpin loop structures (see Fig. 1c) are indicated by different colored boxes, DRs are indicated by arrows, and the putative IHF-binding site is depicted as a red box. The frequencies of mobilization of pNIT101 to pNIT114 from G7(NAH7K3) to KT2400Gm are expressed by the numbers of the Tcr transconjugants per donor cell. Each frequency is the mean value obtained from at least three independent experiments. Statistical analysis was performed using the t test: statistical significance (P < 0.05) in comparison with pNIT101 (*) and with pNIT104 (**).
Article Snippet: These results show that the NAH7 conjugation system has a broader host range than its replication system. table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Binding Assay, Comparison
Journal: Applied and Environmental Microbiology
Article Title: Host Range of the Conjugative Transfer System of IncP-9 Naphthalene-Catabolic Plasmid NAH7 and Characterization of Its oriT Region and Relaxase
doi: 10.1128/AEM.02359-16
Figure Lengend Snippet: Conjugative transfer and mobilization of plasmids a
Article Snippet: These results show that the NAH7 conjugation system has a broader host range than its replication system. table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Plasmid Preparation, Clone Assay
Journal: Applied and Environmental Microbiology
Article Title: Host Range of the Conjugative Transfer System of IncP-9 Naphthalene-Catabolic Plasmid NAH7 and Characterization of Its oriT Region and Relaxase
doi: 10.1128/AEM.02359-16
Figure Lengend Snippet: Mobilization of oriT N -containing plasmid to various bacterial strains a
Article Snippet: These results show that the NAH7 conjugation system has a broader host range than its replication system. table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Plasmid Preparation
Journal: Applied and Environmental Microbiology
Article Title: Host Range of the Conjugative Transfer System of IncP-9 Naphthalene-Catabolic Plasmid NAH7 and Characterization of Its oriT Region and Relaxase
doi: 10.1128/AEM.02359-16
Figure Lengend Snippet: Bacterial strains and plasmids used in this study
Article Snippet: These results show that the NAH7 conjugation system has a broader host range than its replication system. table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Plasmid Preparation, Over Expression
Journal: Applied and Environmental Microbiology
Article Title: Host Range of the Conjugative Transfer System of IncP-9 Naphthalene-Catabolic Plasmid NAH7 and Characterization of Its oriT Region and Relaxase
doi: 10.1128/AEM.02359-16
Figure Lengend Snippet: Primers used in this study
Article Snippet: These results show that the NAH7 conjugation system has a broader host range than its replication system. table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Sequencing, Cloning, Amplification
Journal: Acta Crystallographica. Section F, Structural Biology Communications
Article Title: Crystal structure of the aromatic-amino-acid aminotransferase from Streptococcus mutans
doi: 10.1107/S2053230X18018472
Figure Lengend Snippet: Macromolecule-production information
Article Snippet: Macromolecule-production information is summarized in Table 1 . table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Cloning, Plasmid Preparation, Expressing, Sequencing, Construct, Produced
Journal:
Article Title: In Vitro Activities of Novel 2-Fluoro-Naphthyridine-Containing Ketolides
doi: 10.1128/AAC.49.1.309-315.2005
Figure Lengend Snippet: Antibacterial activities of erythromycin A, telithromycin, JNJ 1, and JNJ 2
Article Snippet: PAEs for telithromycin, JNJ 1, and JNJ 2 were similar against the macrolide-susceptible and -resistant pneumococci (Table ), ranging from 3 to 4 h for the strain OC4409 (macrolide susceptible), to 5 to 6 h for strains OC4430 ( erm ) and OC4427 ( mef ), to 6 to 8 h for strains ATCC 6301 (macrolide susceptible), OC4444 ( erm ), and OC4568 ( mef ). table ft1 table-wrap mode="anchored" t5 TABLE 4.
Techniques:
Journal:
Article Title: In Vitro Activities of Novel 2-Fluoro-Naphthyridine-Containing Ketolides
doi: 10.1128/AAC.49.1.309-315.2005
Figure Lengend Snippet: Inhibition of protein synthesis by erythromycin A, telithromycin, JNJ 1, JNJ 2, and ampicillin
Article Snippet: PAEs for telithromycin, JNJ 1, and JNJ 2 were similar against the macrolide-susceptible and -resistant pneumococci (Table ), ranging from 3 to 4 h for the strain OC4409 (macrolide susceptible), to 5 to 6 h for strains OC4430 ( erm ) and OC4427 ( mef ), to 6 to 8 h for strains ATCC 6301 (macrolide susceptible), OC4444 ( erm ), and OC4568 ( mef ). table ft1 table-wrap mode="anchored" t5 TABLE 4.
Techniques: Inhibition
Journal:
Article Title: In Vitro Activities of Novel 2-Fluoro-Naphthyridine-Containing Ketolides
doi: 10.1128/AAC.49.1.309-315.2005
Figure Lengend Snippet: Decrease in bacterial counts of macrolide-susceptible and -resistant pneumococci after treatment with telithromycin, JNJ 1, or JNJ 2
Article Snippet: PAEs for telithromycin, JNJ 1, and JNJ 2 were similar against the macrolide-susceptible and -resistant pneumococci (Table ), ranging from 3 to 4 h for the strain OC4409 (macrolide susceptible), to 5 to 6 h for strains OC4430 ( erm ) and OC4427 ( mef ), to 6 to 8 h for strains ATCC 6301 (macrolide susceptible), OC4444 ( erm ), and OC4568 ( mef ). table ft1 table-wrap mode="anchored" t5 TABLE 4.
Techniques:
Journal:
Article Title: In Vitro Activities of Novel 2-Fluoro-Naphthyridine-Containing Ketolides
doi: 10.1128/AAC.49.1.309-315.2005
Figure Lengend Snippet: PAE of telithromycin, JNJ 1, and JNJ 2 on S. pneumoniae isolates
Article Snippet: PAEs for telithromycin, JNJ 1, and JNJ 2 were similar against the macrolide-susceptible and -resistant pneumococci (Table ), ranging from 3 to 4 h for the strain OC4409 (macrolide susceptible), to 5 to 6 h for strains OC4430 ( erm ) and OC4427 ( mef ), to 6 to 8 h for strains ATCC 6301 (macrolide susceptible), OC4444 ( erm ), and OC4568 ( mef ). table ft1 table-wrap mode="anchored" t5 TABLE 4.
Techniques:
Journal: Bacteriophage
Article Title: Naturally resident and exogenously applied T4-like and T5-like bacteriophages can reduce Escherichia coli O157:H7 levels in sheep guts
doi: 10.4161/bact.1.1.14175
Figure Lengend Snippet: Electron micrograph of bacteriophage CEV2.
Article Snippet: Restriction enzyme digests of CEV2 have shown that its DNA is digested by Bam HI, Eco RI, Eco RV, Hae III, Hha I, Hin dIII, Pvu II, Sma I and Xho I like that of T5, forming similar fragments, and also like T5 it is not digested by McrBC ( ). fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 1 caption a7 Electron micrograph of bacteriophage CEV2. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 2 caption a7 Pulsed-field gel electrophoresis (PFGE) of undigested and restriction enzyme digested bacteriophage CEV2 DNA. (A) Lane A Sma I:CEV2; Lane B Ecor I:CEV2; Lane C Xho I:CEV2; Lane D TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [121.9 kb] and PEV2 [72.7 kb] and 816a [42.7 kb]; Lane E NEB Hind III:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane F undigested CEV2; Lane G Ecor V:CEV2; Lane H, Pvu II:CEV2; Lane I Hind III:CEV2. (B) Lane A Hha I:CEV2; Lane B Hae III:CEV2; Lane C McrBC:CEV2; Lane D BamH I:CEV2; Lane E TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [120 kb] and PEV2 [70 kb] and 816a [39 kb]; Lane F NEB Hind III:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane G undigested CEV2. table ft1 table-wrap mode="anchored"
Techniques:
Journal: Bacteriophage
Article Title: Naturally resident and exogenously applied T4-like and T5-like bacteriophages can reduce Escherichia coli O157:H7 levels in sheep guts
doi: 10.4161/bact.1.1.14175
Figure Lengend Snippet: Pulsed-field gel electrophoresis (PFGE) of undigested and restriction enzyme digested bacteriophage CEV2 DNA. (A) Lane A SmaI:CEV2; Lane B EcorI:CEV2; Lane C XhoI:CEV2; Lane D TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [121.9 kb] and PEV2 [72.7 kb] and 816a [42.7 kb]; Lane E NEB HindIII:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane F undigested CEV2; Lane G EcorV:CEV2; Lane H, PvuII:CEV2; Lane I HindIII:CEV2. (B) Lane A HhaI:CEV2; Lane B HaeIII:CEV2; Lane C McrBC:CEV2; Lane D BamHI:CEV2; Lane E TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [120 kb] and PEV2 [70 kb] and 816a [39 kb]; Lane F NEB HindIII:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane G undigested CEV2.
Article Snippet: Restriction enzyme digests of CEV2 have shown that its DNA is digested by Bam HI, Eco RI, Eco RV, Hae III, Hha I, Hin dIII, Pvu II, Sma I and Xho I like that of T5, forming similar fragments, and also like T5 it is not digested by McrBC ( ). fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 1 caption a7 Electron micrograph of bacteriophage CEV2. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 2 caption a7 Pulsed-field gel electrophoresis (PFGE) of undigested and restriction enzyme digested bacteriophage CEV2 DNA. (A) Lane A Sma I:CEV2; Lane B Ecor I:CEV2; Lane C Xho I:CEV2; Lane D TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [121.9 kb] and PEV2 [72.7 kb] and 816a [42.7 kb]; Lane E NEB Hind III:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane F undigested CEV2; Lane G Ecor V:CEV2; Lane H, Pvu II:CEV2; Lane I Hind III:CEV2. (B) Lane A Hha I:CEV2; Lane B Hae III:CEV2; Lane C McrBC:CEV2; Lane D BamH I:CEV2; Lane E TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [120 kb] and PEV2 [70 kb] and 816a [39 kb]; Lane F NEB Hind III:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane G undigested CEV2. table ft1 table-wrap mode="anchored"
Techniques: Pulsed-Field Gel, Electrophoresis
Journal: Bacteriophage
Article Title: Naturally resident and exogenously applied T4-like and T5-like bacteriophages can reduce Escherichia coli O157:H7 levels in sheep guts
doi: 10.4161/bact.1.1.14175
Figure Lengend Snippet: Host range of bacteriophage CEV2
Article Snippet: Restriction enzyme digests of CEV2 have shown that its DNA is digested by Bam HI, Eco RI, Eco RV, Hae III, Hha I, Hin dIII, Pvu II, Sma I and Xho I like that of T5, forming similar fragments, and also like T5 it is not digested by McrBC ( ). fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 1 caption a7 Electron micrograph of bacteriophage CEV2. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 2 caption a7 Pulsed-field gel electrophoresis (PFGE) of undigested and restriction enzyme digested bacteriophage CEV2 DNA. (A) Lane A Sma I:CEV2; Lane B Ecor I:CEV2; Lane C Xho I:CEV2; Lane D TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [121.9 kb] and PEV2 [72.7 kb] and 816a [42.7 kb]; Lane E NEB Hind III:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane F undigested CEV2; Lane G Ecor V:CEV2; Lane H, Pvu II:CEV2; Lane I Hind III:CEV2. (B) Lane A Hha I:CEV2; Lane B Hae III:CEV2; Lane C McrBC:CEV2; Lane D BamH I:CEV2; Lane E TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [120 kb] and PEV2 [70 kb] and 816a [39 kb]; Lane F NEB Hind III:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane G undigested CEV2. table ft1 table-wrap mode="anchored"
Techniques: Bacteria
Journal: Bacteriophage
Article Title: Naturally resident and exogenously applied T4-like and T5-like bacteriophages can reduce Escherichia coli O157:H7 levels in sheep guts
doi: 10.4161/bact.1.1.14175
Figure Lengend Snippet: Patterns of infection of CEV2 and T5 against FhuA + /Fhu − and tonB − E. coli strains
Article Snippet: Restriction enzyme digests of CEV2 have shown that its DNA is digested by Bam HI, Eco RI, Eco RV, Hae III, Hha I, Hin dIII, Pvu II, Sma I and Xho I like that of T5, forming similar fragments, and also like T5 it is not digested by McrBC ( ). fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 1 caption a7 Electron micrograph of bacteriophage CEV2. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 2 caption a7 Pulsed-field gel electrophoresis (PFGE) of undigested and restriction enzyme digested bacteriophage CEV2 DNA. (A) Lane A Sma I:CEV2; Lane B Ecor I:CEV2; Lane C Xho I:CEV2; Lane D TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [121.9 kb] and PEV2 [72.7 kb] and 816a [42.7 kb]; Lane E NEB Hind III:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane F undigested CEV2; Lane G Ecor V:CEV2; Lane H, Pvu II:CEV2; Lane I Hind III:CEV2. (B) Lane A Hha I:CEV2; Lane B Hae III:CEV2; Lane C McrBC:CEV2; Lane D BamH I:CEV2; Lane E TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [120 kb] and PEV2 [70 kb] and 816a [39 kb]; Lane F NEB Hind III:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane G undigested CEV2. table ft1 table-wrap mode="anchored"
Techniques: Infection
Journal: Bacteriophage
Article Title: Naturally resident and exogenously applied T4-like and T5-like bacteriophages can reduce Escherichia coli O157:H7 levels in sheep guts
doi: 10.4161/bact.1.1.14175
Figure Lengend Snippet: High MOI CEV2 infections of E. coli O157:H7 NCTC 12900 growing either aerobically (A, MOI∼5.3) or anaerobically (B, MOI∼8.3) in TSB. Infection graphs shown are representative of at least three replicates. Bacterial survivors CFU mL−1 (▵), OD600 nm (○) and phage PFU mL−1 after the addition of chloroform (□).
Article Snippet: Restriction enzyme digests of CEV2 have shown that its DNA is digested by Bam HI, Eco RI, Eco RV, Hae III, Hha I, Hin dIII, Pvu II, Sma I and Xho I like that of T5, forming similar fragments, and also like T5 it is not digested by McrBC ( ). fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 1 caption a7 Electron micrograph of bacteriophage CEV2. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 2 caption a7 Pulsed-field gel electrophoresis (PFGE) of undigested and restriction enzyme digested bacteriophage CEV2 DNA. (A) Lane A Sma I:CEV2; Lane B Ecor I:CEV2; Lane C Xho I:CEV2; Lane D TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [121.9 kb] and PEV2 [72.7 kb] and 816a [42.7 kb]; Lane E NEB Hind III:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane F undigested CEV2; Lane G Ecor V:CEV2; Lane H, Pvu II:CEV2; Lane I Hind III:CEV2. (B) Lane A Hha I:CEV2; Lane B Hae III:CEV2; Lane C McrBC:CEV2; Lane D BamH I:CEV2; Lane E TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [120 kb] and PEV2 [70 kb] and 816a [39 kb]; Lane F NEB Hind III:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane G undigested CEV2. table ft1 table-wrap mode="anchored"
Techniques: Infection
Journal: Bacteriophage
Article Title: Naturally resident and exogenously applied T4-like and T5-like bacteriophages can reduce Escherichia coli O157:H7 levels in sheep guts
doi: 10.4161/bact.1.1.14175
Figure Lengend Snippet: High MOI (∼3.9) co-infection of E. coli O157:H7 NCTC 12900 growing anaerobically in TSB with phages CEV1 (∼2.06) and CEV2 (∼1.88). Bacterial survivors (▵), OD600 nm (○) and phage titers, CEV1 (solid line) and CEV2 (dashed line) after the addition of chloroform (□).
Article Snippet: Restriction enzyme digests of CEV2 have shown that its DNA is digested by Bam HI, Eco RI, Eco RV, Hae III, Hha I, Hin dIII, Pvu II, Sma I and Xho I like that of T5, forming similar fragments, and also like T5 it is not digested by McrBC ( ). fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 1 caption a7 Electron micrograph of bacteriophage CEV2. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 2 caption a7 Pulsed-field gel electrophoresis (PFGE) of undigested and restriction enzyme digested bacteriophage CEV2 DNA. (A) Lane A Sma I:CEV2; Lane B Ecor I:CEV2; Lane C Xho I:CEV2; Lane D TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [121.9 kb] and PEV2 [72.7 kb] and 816a [42.7 kb]; Lane E NEB Hind III:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane F undigested CEV2; Lane G Ecor V:CEV2; Lane H, Pvu II:CEV2; Lane I Hind III:CEV2. (B) Lane A Hha I:CEV2; Lane B Hae III:CEV2; Lane C McrBC:CEV2; Lane D BamH I:CEV2; Lane E TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [120 kb] and PEV2 [70 kb] and 816a [39 kb]; Lane F NEB Hind III:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane G undigested CEV2. table ft1 table-wrap mode="anchored"
Techniques: Infection
Journal: Bacteriophage
Article Title: Naturally resident and exogenously applied T4-like and T5-like bacteriophages can reduce Escherichia coli O157:H7 levels in sheep guts
doi: 10.4161/bact.1.1.14175
Figure Lengend Snippet: Patterns of resistance of bacterial survivors after phage infection of strain NCTC 12900
Article Snippet: Restriction enzyme digests of CEV2 have shown that its DNA is digested by Bam HI, Eco RI, Eco RV, Hae III, Hha I, Hin dIII, Pvu II, Sma I and Xho I like that of T5, forming similar fragments, and also like T5 it is not digested by McrBC ( ). fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 1 caption a7 Electron micrograph of bacteriophage CEV2. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 2 caption a7 Pulsed-field gel electrophoresis (PFGE) of undigested and restriction enzyme digested bacteriophage CEV2 DNA. (A) Lane A Sma I:CEV2; Lane B Ecor I:CEV2; Lane C Xho I:CEV2; Lane D TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [121.9 kb] and PEV2 [72.7 kb] and 816a [42.7 kb]; Lane E NEB Hind III:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane F undigested CEV2; Lane G Ecor V:CEV2; Lane H, Pvu II:CEV2; Lane I Hind III:CEV2. (B) Lane A Hha I:CEV2; Lane B Hae III:CEV2; Lane C McrBC:CEV2; Lane D BamH I:CEV2; Lane E TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [120 kb] and PEV2 [70 kb] and 816a [39 kb]; Lane F NEB Hind III:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane G undigested CEV2. table ft1 table-wrap mode="anchored"
Techniques: Infection
Journal: Bacteriophage
Article Title: Naturally resident and exogenously applied T4-like and T5-like bacteriophages can reduce Escherichia coli O157:H7 levels in sheep guts
doi: 10.4161/bact.1.1.14175
Figure Lengend Snippet: The use of O157:H7-infecting phage CEV1 or a cocktail of CEV1+CEV2 as a pre-slaughter treatment to remove resident E. coli O157:H7 EDL 933 from the intestines of ruminants (sheep). Group 1 (white): Control Group, O157:H7-infecting phage free and receiving no phage treatment. Group 2 (gray): Cocktail (CEV1+CEV2). Treatment Group, O157:H7-infecting phage free and treated with CEV1 and CEV2. Group 3 (black): Naturally Resident CEV2 Phage Group: Sheep in which CEV2 was naturally present. Error bars indicate standard deviations.
Article Snippet: Restriction enzyme digests of CEV2 have shown that its DNA is digested by Bam HI, Eco RI, Eco RV, Hae III, Hha I, Hin dIII, Pvu II, Sma I and Xho I like that of T5, forming similar fragments, and also like T5 it is not digested by McrBC ( ). fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 1 caption a7 Electron micrograph of bacteriophage CEV2. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 2 caption a7 Pulsed-field gel electrophoresis (PFGE) of undigested and restriction enzyme digested bacteriophage CEV2 DNA. (A) Lane A Sma I:CEV2; Lane B Ecor I:CEV2; Lane C Xho I:CEV2; Lane D TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [121.9 kb] and PEV2 [72.7 kb] and 816a [42.7 kb]; Lane E NEB Hind III:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane F undigested CEV2; Lane G Ecor V:CEV2; Lane H, Pvu II:CEV2; Lane I Hind III:CEV2. (B) Lane A Hha I:CEV2; Lane B Hae III:CEV2; Lane C McrBC:CEV2; Lane D BamH I:CEV2; Lane E TESC Lab Phage PFGE Ladder consisting of PEV3 [290 kb], T4 [175 kb], T5 [120 kb] and PEV2 [70 kb] and 816a [39 kb]; Lane F NEB Hind III:λ ladder [23.1, 9.4, 6.6, 4.4 kb]; Lane G undigested CEV2. table ft1 table-wrap mode="anchored"
Techniques: Control